euL1db - The European database of L1-HS retrotransposon insertions in humans

Chromosome #	Start	Stop	Strand	Reference Start	Reference Stop
15	67625581	67625581	-	0	0

Comments

.

PCR results ID	Target Site Size	PolyA Size	Inversion	3 Prime Transduction	5 Prime Transduction
validated	13	71	no	Yes	no

Class	Family	Sub Family	Sub Group	Integrity	Lineage
LINE	L1	L1HS	unknown	full-length	somatic

Target Site Duplication	Primer 1	Primer 2
TCCTTAGTAAAAA_	ATCCCATTCATGACGATTCC	.

L1 Sequence

.

5' Junction PCR	3' Junction PCR	MRIP ID	Allele Frequency	L1 Activity
yes	no	mrip2654	.	.

Clinical	Tissue	Sub Tissue	Individual	Relationship
Healthy	Brain	Cortex	1465-Cortex_Tissue_1-neuron_MDA_2	Multiple

euL1db The European database of L1-HS retrotransposon insertions in humans