euL1db - The European database of L1-HS retrotransposon insertions in humans

Chromosome #	Start	Stop	Strand	Reference Start	Reference Stop
6	45934271	45934271	+	0	0

Comments

.

PCR results ID	Target Site Size	PolyA Size	Inversion	3 Prime Transduction	5 Prime Transduction
validated	.	0	no	no	no

Class	Family	Sub Family	Sub Group	Integrity	Lineage
LINE	L1	L1HS	unknown	unknown	germline

Target Site Duplication	Primer 1	Primer 2
.	GTGGAGATGCAACCATAAAAAT	AGACATCCCAAAATCTGTCATC

L1 Sequence

.

5' Junction PCR	3' Junction PCR	MRIP ID	Allele Frequency	L1 Activity
yes	no	mrip6791	.	.

Clinical	Tissue	Sub Tissue	Individual	Relationship
Healthy	unknown	unknown	JapnIMo	Solo

euL1db The European database of L1-HS retrotransposon insertions in humans